DNAConverter app analytics for January 18

Want to say something, but also… not really? This app lets you hide those feelings inside ATCG. If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app. ■Text → Nucleotide Sequence “Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful! Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.” ■Nucleotide Sequence → Text Even ATCG-only cryptic messages can be decoded back to the original text. Perfect for private “secret code” chats among friends. ■Features • Generates DNA-like sequences instantly, even though they mean nothing • Copy & paste into messaging apps for quick sharing • Decode mode for conversations only insiders can understand • Absolutely no biological meaning whatsoever Even the words you can’t say out loud might feel lighter when you hide them in ATCG.