You’ve hit your search limit
Start your free trial to keep exploring full traffic and performance insights.
Get Started- Pagina principale
- Analisi dell'app gratuita
- DNAConverter
DNAConverter analisi dell'app per 18 gennaio
DNAConverter
- makoto amijima
- App Store di Apple
- A pagamento
- Servizi
Want to say something, but also… not really?
This app lets you hide those feelings inside ATCG.
If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.
■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!
Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”
■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.
■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever
Even the words you can’t say out loud might feel lighter when you hide them in ATCG.
Classifica degli store
La classifica del store si basa su diversi parametri stabiliti da Google e Apple.
Tutte le categorie in
Stati Uniti--
Servizi in
Stati Uniti--
Crea un account per visualizzare il numero mensile medio di downloadContattaci
DNAConverterStatistiche di ranking nel tempo
Classifica di Utilizzo di Similarweb e Classifica App Store di Apple per DNAConverter
Rank
Nessun dato disponibile
DNAConverter Classifica per paese
Paesi in cui DNAConverter ha la posizione più alta nelle sue categorie principali
Nessun dato da visualizzare
Principali concorrenti e app alternative
App con un'alta probabilità di essere utilizzate dagli stessi utenti, provenienti dallo stesso store.
EZ Pomo
Mika Urakawa
名札交換
Ryoga Tanaka
HAB - Smart Habit Tracker
浩 吴
NewsTeller
Luxx GmbH
gennaio 18, 2026